Г. С. Русских Общая характеристика работы



На правах рукописи


Величко

Лена Юрьевна


РОЛЬ Веб-сайтов ВЗАИМОДЕЙСТВИЯ ДНК С КОМПЛЕКСОМ СТЕРОИДНЫЙ ГОРМОН – АПОЛИПОПРОТЕИН А-I В РЕГУЛЯЦИИ ТРАНСКРИПЦИИ


03.00.04 – биохимия

03.00.03 – молекулярная биология



А В Т О Р Е Ф Е Р А Т
диссертации на соискание ученой степени

кандидата Г. С. Русских Общая характеристика работы био наук


Новосибирск – 2008

Работа выполнена в Муниципальном учреждении Научно-исследовательском институте биохимии СО РАМН, г. Новосибирск

Научные руководители:
академик РАМН,

доктор мед наук, доктор

^ Панин Лев Евгеньевич


доктор био наук

Гимаутдинова Ольга Ивановна


Официальные оппоненты:

доктор био Г. С. Русских Общая характеристика работы наук

Гришанова Алевтина Юрьевна


доктор био наук

^ Усынин Иван Федорович


Ведущая организация: Институт хим биологии и базовой медицины СО РАН, г. Новосибирск


Защита диссертации состоится «____»_______________2008 г.

в _____часов на заседании диссертационного совета Д 001.034.01 в Муниципальном Г. С. Русских Общая характеристика работы учреждении Научно-исследовательском институте биохимии СО РАМН по адресу: 630117, г. Новосибирск, ул. Академика Тимакова, 2


С диссертацией можно ознакомиться в библиотеке Муниципального учреждения Научно-исследовательского института биохимии СО РАМН


Автореферат разослан Г. С. Русских Общая характеристика работы «______» ____________________2008 г.


Ученый секретарь

диссертационного совета,

кандидат био наук ^ Г.С. Российских

Общая черта работы

Актуальность темы. Данная работа посвящена исследованию молекулярных устройств гормональной регуляции транскрипции. Понятно, что адаптивные характеристики гормонов, обычно, реализуются через взаимодействие Г. С. Русских Общая характеристика работы с геномом клеточки, приводя к усилению экспрессии либо, напротив, к супрессии отдельных генов. Невзирая на пристальное внимание ученых к данной дилемме многие этапы этого взаимодействия до сего времени неясны. Довольно много исследованы молекулярные Г. С. Русских Общая характеристика работы механизмы индукции главных ферментов глюконеогенеза при участии гормонов пучковой зоны коры надпочечников и цитозольного сенсора этих гормонов (Mangelsford D. J. et al., 1995; Libri V. et al., 2004). Но механизмы взаимодействия гормон-рецепторных комплексов с Г. С. Русских Общая характеристика работы ДНК исследованы недостаточно.

В Институте биохимии СО РАМН ранее было открыто явление стимуляции резидентными макрофагами биосинтеза белка в паренхимных клеточках органов и тканей в процессе регенерации, в каком принципную роль игрались стероидные Г. С. Русских Общая характеристика работы гормоны и липопротеины высочайшей плотности 3 подкласса (ЛПВП3) (Панин Л.Е., Усынин И.Ф., Харьковский А.В., 1994; 1999). Показано, что функцию переносчика стероидных гормонов в ядра клеток в данном механизме делает аполипопротеин Г. С. Русских Общая характеристика работы A-I (апоA-I) (Панин Л.Е. и др., 1992). Образование на биологическом уровне активного комплекса стероидный гормон-аполипопротеин A-I протекает в резидентных макрофагах. Потом осуществляется перенос данного комплекса в ядра соматических клеток, где Г. С. Русских Общая характеристика работы он ведет взаимодействие с депротеинизированными участками ДНК с следующим усилением экспрессии генов. Молекулярные механизмы данного явления почти во всем еще не раскрыты. К ним следует отнести определение веб-сайтов взаимодействия комплексов стероидный гормон Г. С. Русских Общая характеристика работы-аполипопротеин A-I с ДНК и их роль в активации транскрипции. Так, ранее было показано, что комплекс стероидный гормон (тетрагидрокортизол, дегидроэпиандростерон-сульфат)-аполипопротеин A-I ведет взаимодействие в большей степени Г. С. Русских Общая характеристика работы с GCC/CGG-последовательностями в изолированной ДНК (Панин Л.Е. и др., 2002; Panin L.E. et. al., 2003). Но ряд деталей этого взаимодействия можно узнать лишь на синтетических олигонуклеотидах, а не на нативной ДНК Г. С. Русских Общая характеристика работы. Сейчас это принципиальное и недостающее звено в исследовании не только лишь устройств усиления экспрессии генов, да и копирования ДНК. Решение этих вопросов очень животрепещуще для осознания молекулярных устройств гормональной индукции синтеза Г. С. Русских Общая характеристика работы белков, их роли в процессах регенерации и пролиферации клеток.

^ Цель и задачки исследования

Целью данного исследования являлось исследование молекулярных устройств деяния комплексов стероидный гормон (тетрагидрокортизол, кортизол)-аполипопротеин A-I на вторичную структуру Г. С. Русских Общая характеристика работы синтетических олигонуклеотидов вида (gCC)n и их комплементарных дуплексов, также на транскрипцию ДНК крысы.

Для заслуги поставленной цели нужно было решить последующие задачки:

1. Установить вероятные нуклеотидные последовательности веб-сайтов связывания комплексов стероидный Г. С. Русских Общая характеристика работы гормон-апоA-I (где стероидный гормон – ТГК либо кортизол) с ДНК. Найти устойчивость их к действию ДНКазы I и нуклеазы S1 после взаимодействия с комплексом тетрагидрокортизол-апоА-I;

2. Изучить воздействие комплексов стероидный гормон-апоA Г. С. Русских Общая характеристика работы-I (где стероидный гормон – ТГК либо кортизол) на вторичную структуру синтетических олигонуклеотидов и их комплементарных дуплексов;

3. Оценить воздействие метилирования олигонуклеотидов вида (gCC/ggC)n на их взаимодействие с комплексом стероидный гормон-апоА-I Г. С. Русских Общая характеристика работы;

4. Изучить воздействие комплексов стероидный гормон-апоA-I на транскрипцию ДНК in vitro.

Научная новизна работы

В первый раз определены мало достаточные нуклеотидные последовательности, специфически взаимодействующие с комплексом тетрагидрокортизол-аполипопротеин A-I. Найдены Г. С. Русских Общая характеристика работы концевые нуклеотиды последовательностей, усиливающие связывание с обозначенным комплексом. Показано, что последовательность, связывающая комплекс тетрагидрокортизол-аполипопротеин A-I и труднодоступная действию нуклеаз, представляет собой 5`-gg(Cgg)3T3.

В первый раз показано Г. С. Русских Общая характеристика работы, что метилирование оснований в нуклеотидах CpG не препятствует связыванию олигонуклеотидного дуплекса вида gCC/ggC с комплексом ТГК-апоА-I. На модельных олигонуклеотидных дуплексах AnCC(gCC)3●gg(Cgg)3Tn (n=0, 3 и 6) подтверждено «расплетающее Г. С. Русских Общая характеристика работы» действие комплекса ТГК-апоА-I.

В первый раз показано, что комплекс тетрагидрокортизол-аполипопротеин А-I дозозависимо активирует транскрипцию ДНК крысы in vitro, выполняя роль, схожую роли транскрипционного фактора, изменяющего структуру ДНК в веб-сайтах Г. С. Русских Общая характеристика работы связывания, в процессе транскрипции.

^ Теоретическая и практическая значимость работы

Приобретенные данные заносят значимый вклад в осознание молекулярных устройств гормональной регуляции синтеза белков в соматических клеточках. Показано, что важную роль в этих механизмах Г. С. Русских Общая характеристика работы играет таковой адресный переносчик стероидных гормонов в ядра клеток как аполипопротеин А-I. Определение мало достаточного веб-сайта связывания ДНК с комплексом стероидный гормон-аполипопротеин А-I и особенности их взаимодействия значительно дополняют современные Г. С. Русских Общая характеристика работы представления о структурно-функциональной организации генома эукариот. Приобретенные данные открывают новые механизмы гормональной регуляции экспрессии генов, их роли в регенерации и пролиферации клеток, в том числе, и при опухолевых Г. С. Русских Общая характеристика работы процессах. Приобретенные результаты могут быть применены при обосновании новых способов корректировки и исцеления как пролиферативных, так и дегенеративно-деструктивных процессов в органах и тканях.


^ Главные положения, выносимые на защиту

  1. Аполипопротеин A-I в Г. С. Русских Общая характеристика работы составе комплекса со стероидными гормонами (где стероидный гормон – ТГК либо кортизол) имеет высочайшее сродство как к природной ДНК, так и к GC-богатым синтетическим олигодезоксирибонуклеотидам различного состава.

  2. Связывание комплекса ТГК-апоA-I Г. С. Русских Общая характеристика работы с олигонуклеотидными дуплексами вида (gCC/Cgg)n приводит к образованию одноцепочечных (S1-нуклеазочувствительных) участков. Метилирование оснований в нуклеотидах не препятствует связыванию комплекса ТГК-апоA-I с комплементарным дуплексом.

  3. Мало достаточная для связывания Г. С. Русских Общая характеристика работы комплекса ТГК-апоA-I нуклеотидная последовательность, труднодоступная действию S1 нуклеазы и ДНКазы I, представляет собой олигонуклеотид gg(Cgg)3T3.

  4. Транскрипция in vitro ДНК крысы, катализируемая РНК-полимеразами белкового экстракта ядер из клеток Г. С. Русских Общая характеристика работы печени, дозозависимо активизируется комплексом ТГК-апоА-I; но при 200-кратном мольном излишке комплекса транскрипция ингибируется стопроцентно.

^ Апробация работы и публикации

Материалы диссертации изложены в 4 публикациях и были представлены на интернациональной школе юных ученых (BGRS Г. С. Русских Общая характеристика работы, Новосибирск, 2005 г.), доложены на ученом совете Института Биохимии СО РАМН.

Структура и объем работы: диссертация изложена на 137 страничках машинописного текста, включая 2 таблицы и 22 рисунка. Работа состоит из введения, обзора литературы, описания материалов и способов Г. С. Русских Общая характеристика работы исследовательских работ, результатов собственных исследовательских работ, обсуждения результатов, заключения, выводов и перечня цитируемой литературы. Перечень литературных источников содержит 195 ссылок, включая 57 российских.

^ Главные Способы ИССЛЕДОВАНИЯ

  1. Выделение ЛПВП способом изоплотностного ультрацентрифугирования (Hatch F. T., Less Г. С. Русских Общая характеристика работы R. S., 1968).

  2. Выделение апоА-I из апоЛПВП способом электрофореза по Лэммли (Laemmli U. K., 1970) в препаративном варианте.

  3. Выделение нативной ДНК из печени крысы полосы Вистар (Karlinsey J. et al., 1989).

  4. Выделение Г. С. Русских Общая характеристика работы белкового экстракта из ядер клеток печени крысы по (Dignam J. D. et al., 1983) с своими модификациями.

  5. Аффинная хроматография олигонуклеотидов.

  6. Введение 32Р-метки в олигонуклеотиды (Маниатис Т. и др. 1984).

  7. Титрование смесей олигонуклеотидов, комплементарных дуплексов и Г. С. Русских Общая характеристика работы ДНК комплексами стероидный гормон-апоА-I (Гимаутдинова О. И. и др., 1998).

  8. Ферментативный анализ структуры олигонуклеотидов, ДНК и их товаров с применением нуклеазы S1 (Vogt V.M., 1973), ДНКазы I (Sambrook Г. С. Русских Общая характеристика работы J., et al., 1989), метилазы M.Fsp4HI и рестриктазы Fsp4HI (Zingg J. M., Jones P. A., 1997; Власова Т. И. и др., 1996).

  9. Реакция транскрипции на матрицах ДНК крысы и хроматина in vitro.

  10. Электрофорез Г. С. Русских Общая характеристика работы олигонуклеотидов, ДНК и РНК в полиакриламидном геле.

^ Главные РЕЗУЛЬТАТЫ РАБОТЫ И ИХ ОБСУЖДЕНИЕ

Полное описание результатов приведено в диссертации, в автореферат вынесены результаты, определяющие теоретическую и практическую значимость, также новизну исследования.

Ранее было Г. С. Русских Общая характеристика работы показано воздействие комплексов стероидный гормон–апоА-I (где стероидный гормон – ТГК либо кортизол) на вторичную структуру ДНК, в состав которой входят исследуемые нами последовательности нуклеотидов (рис. 1) (Панин Л. Е., Гимаутдинова О. И. и др Г. С. Русских Общая характеристика работы., 1998), потому можно было ждать аналогичное воздействие на олигонуклеотиды и их комплементарные дуплексы.

^ Взаимодействие олигонуклеотидов и их комплементарных дуплексов с комплексами ТГК–апоА-I либо кортизол–апоА-I

В опыте были применены Г. С. Русских Общая характеристика работы два вида GC-олигонуклеотидов: содержащие An либо Tn-последовательности на 5`- и 3`-концах, соответственно (рис. 1).

Г1 – 5`-CC(gCC)3

Г2 – 5`-gg(Cgg)3

Г1А6 – 5`-А6CC(gCC)3

Г2Т6 – 5`-gg(Cgg)3T6

Г Г. С. Русских Общая характеристика работы1А3 – 5`-A3CC(gCC)3

Г2Т3 – 5`-gg(Cgg)3T3

ON1 – 5`-СС(gCC)5




ON2 – 5`-pATCTTTAACTGATGAACTTCT

ON3 – 5`-pTGCCTGGAGCTGCTTGATGC

Рис. 1. Нуклеотидные последовательности использованных в работе олигонуклеотидов, моделей веб-сайтов связывания ДНК с комплексом ТГК-апоА-I.


Последовательность (gCC Г. С. Русских Общая характеристика работы)3 является регуляторной (т.е. той последовательностью, с которой связываются транскрипционные причины либо другие регуляторные белки) для гена белка апоА-I человека (Перевозчиков А., 1997), также встречается в промоторах других генов (Кузнецов П. А., 2004).

В Г. С. Русских Общая характеристика работы нашей работе показано, что апоА-I способен связываться с олигонуклеотидами в составе комплекса с ТГК и кортизолом. Наибольшим эффектом на структуру ДНК обладает комплекс состава 1 молекула белка – 2 молекулы гормона (Кузнецов Г. С. Русских Общая характеристика работы П. А., 2004). Таковой комплекс, по-видимому, обладает хорошей конформацией для наибольшего воздействия на структуру ДНК.

На рис. 2 представлены данные по сродству олигонуклеотидов к комплексу ТГК-апоА-I (А и Б) и к комплексу кортизол-апоА Г. С. Русских Общая характеристика работы-I (В) (стероидный гормон : белок – 2:1, моль/моль), приобретенных аффинной хроматографией на колонке с Сефарозой 4В с пришитыми поликлональными антителами к апоА-I (синтезирована О. И. Гимаутдиновой).

Комплексы стероидный гормон-апоАI (где стероидный Г. С. Русских Общая характеристика работы гормон – ТГК либо кортизол) связываются со всеми синтетическими олигодезоксирибонуклеотидами различного состава и длины (рис. 1), применяемыми в опыте, не считая Т19 (рис. 2 А, Б, дорвей. 1, 6). Для данного олигонуклеотида приметного связывания с Г. С. Русских Общая характеристика работы комплексом ТГК-апоА-I найдено не было.





Рис. 2. Радиоавтографы 15% ПААГ после разделения электрофорезом Р32-олигонуклеотидов, элюированных с сорбента Сефароза-антиапоАI:апоАI-стероидный гормон (где стероидный гормон – ТГК либо кортизол); ( # ) - метка введена до аффинной хроматографии Г. С. Русских Общая характеристика работы. В каждом опыте на колонку с аффинным сорбентом наносили однообразное количество молей олигонуклеотидов.

А – сродство олигонуклеотидов к комплексу ТГК-апоА-I.

  1. Т19;

  2. #ON1 (5`-СС(gCC)5);

  3. ON2 (5`-pTGCCTGGAGCTGCTTGATGC);

  4. ON3 (5`-pATCTTTAACTGATGAACTTCT);

  5. ON1 (5`-СС Г. С. Русских Общая характеристика работы(gCC)5).

Б – сродство олигонуклеотидов к комплексу ТГК-апоА-I.

  1. #Т19;

  2. Г2 (5`-gg(Cgg)3);

  3. Г2Т3 (5`-gg(Cgg)3Т3);

  4. Г2Т6 (5`-gg(Cgg)3Т6).

В – сродство олигонуклеотидов к комплексу кортизол-апоА-I.

  1. Г2Т Г. С. Русских Общая характеристика работы3;

  2. Г2Т6.


Большим сродством к комплексу ТГК–апoA-I владеют олигонуклеотиды, содержащие Tn на 3`-конце (Г2Т3 и Г2Т6), т.к. на радиоавтографе обнаруживалось более приметное их присутствие (рис. 2 Б, дорвей Г. С. Русских Общая характеристика работы. 8, 9). Также найдено связывание Tn-содержащих олигонуклеотидов (Г2Т3 и Г2Т6) с апоА-I в комплексе с другим стероидным гормоном – кортизолом, но в наименьшей степени (рис. 2 В, дорвей. 8-10 и 9-11).

Из рис. 2 можно Г. С. Русских Общая характеристика работы заключить, что электрофоретические подвижности в 15% ПААГ исследуемых олигонуклеотидов, соотнесенные с маркерными красителями ХС и BP, соответствуют литературным (Мазин А. В., Кузнеделов К. Д., 1986).


^ Изменение чувствительности к S1 нуклеазе и ДНКазе I Г. С. Русских Общая характеристика работы олигонуклеотидов и их комплементарных дуплексов под воздействием комплексов ТГК-апоА-I либо кортизол-апоА-I

Подготовительная обработка ДНК комплексом апоА-I – стероидный гормон (кортизол и ТГК, АС, ДЭА, ДЭАС) приводит к возникновению дополнительных S Г. С. Русских Общая характеристика работы1-нуклеазочувствительных участков (Кузнецов П. А., 2004) и защищает от деяния ДНКазы I.



(метаболит кортизола)

Рис. 3. Структура стероидных гормонов, которые использовались в данной работе.


Проведенные нами опыты проявили, что инкубация с комплексом Г. С. Русских Общая характеристика работы ТГК-апоА-I дуплексов комплементарных олигонуклеотидов приводит к возникновению S1-нуклеазочувствительных участков, чего не наблюдается для необработанных комплексом ТГК-апоА-I комплементарных дуплексов. Олигонуклеотиды, имеющие Аn-последовательности на 5`-конце, оказались более подвержены Г. С. Русских Общая характеристика работы гидролизу нуклеазой S1 и ДНКазой I, чем олигонуклеотиды, имеющие Тn-последовательности на 3`-конце либо олигонуклеотиды, не имеющие Тn- и Аn-последовательностей на 3`- и 5`-концах, соответственно.

При подготовительной обработке комплементарных дуплексов комплексом кортизол-апоА-I Г. С. Русских Общая характеристика работы не наблюдалось возникновения S1-нуклеазочувствительных участков. По-видимому, различие в действии комплексов апоА-I с ТГК и кортизолом связано с отсутствием ОН-группы в А-кольце у кортизола (рис. 3), что Г. С. Русских Общая характеристика работы приводит к другой конформации комплекса стероидный гормон-апоА-I.

Ниже представлены результаты гидролиза олигонуклеотидов (рис. 1) и их дуплексов, инкубированных с комплексами ТГК-апоА-I (рис. 4 и 6) и кортизол-апоА-I (рис. 5 и 7), нуклеазой S Г. С. Русских Общая характеристика работы1 и ДНКазой I.

Дуплекс Г1•Г2, образованный комплементарными олигонуклеотидами Г1 и Г2 (рис. 4, дорвей. 1), инкубировали с комплексом ТГК-апоА-I при молярных соотношениях дуплекс : комплекс 1:0,5 (дорвей. 3) и 1:2 (дорвей. 4), потом обрабатывали Г. С. Русских Общая характеристика работы нуклеазой S1 (дорвей. 2, 3 и 4). Олигонуклеотиды Г1 и Г2 (рис. 4, дорвей. 5 и 9, соответственно) также за ранее инкубировали с комплексом ТГК-апоА-I при молярных соотношениях дуплекс : комплекс 1:0,5 (дорвей. 7 и 11) и 1:2 (дорвей. 8 и 12), потом обрабатывали Г. С. Русских Общая характеристика работы нуклеазой S1 (дорвей. 6-8 и 10-12). Дорожки 1, 5 и 9 – контрольные.

Как надо из рис. 4, нуклеаза S1 фактически стопроцентно расщепляет однонитевые олигонуклеотиды Г1 (дорвей. 6) и Г2 (дорвей. 10), в то время как дуплекс Г1•Г2 остается Г. С. Русских Общая характеристика работы негидролизованным (дорвей. 2), что соответствует литературным данным (Vogt V. M., 1973).



—XC


—BP


Продукты

гидролиза

нуклеазой S1

1 2 3 4 5 6 7 8 9 10 11 12





Рис. 4. Радиоавтограф 20% ПААГ после разделения электрофорезом товаров гидролиза олигонуклеотидов Г1 и Г2 и их дуплекса Г1•Г2 нуклеазой S1 в присутствии и Г. С. Русских Общая характеристика работы в отсутствие комплекса ТГК-апоА-I.

  1. Г1•Г2 (5`-CC(gCC)35`-gg(Cgg)3);

  2. Г1•Г2 (5`-CC(gCC)35`-gg(Cgg)3) + нуклеаза S1;

  3. Г1•Г2 (5`-CC(gCC)35`-gg(Cgg)3) + [ТГК-апоА-I] + нуклеаза S Г. С. Русских Общая характеристика работы1 при молярном соотношении дуплекс : комплекс – 1:0,5;

  4. Г1•Г2 (5`-CC(gCC)35`-gg(Cgg)3) + [ТГК-апоА-I] + нуклеаза S1 (1:2);

  5. Г1 (5`-CC(gCC)3);

  6. Г1 (5`-CC(gCC)3) + нуклеаза S1;

  7. Г1 (5`-CC(gCC)3) + [ТГК-апоА-I] + нуклеаза S1, при молярном Г. С. Русских Общая характеристика работы соотношении олигонуклеотид : комплекс – 1:0,5;

  8. Г1 (5`-CC(gCC)3) + [ТГК-апоА-I] + нуклеаза S1 (1:2);

  9. Г2 (5`-gg(Cgg)3);

  10. Г2 (5`-gg(Cgg)3) + нуклеаза S1;

  11. Г2 (5`-gg(Cgg)3) + [ТГК-апоА-I] + нуклеаза S1 (1:0,5);

  12. Г2 (5`-gg(Cgg Г. С. Русских Общая характеристика работы)3) + [ТГК-апоА-I] + нуклеаза S1 (1:2).


Подготовительная инкубация олигонуклеотидов Г1 и Г2 с комплексом ТГК-апоА-I защищает их от деяния нуклеазы S1 (рис. 4, дорвей. 7-8, 11-12), при этом, чем выше концентрация комплекса, тем Г. С. Русских Общая характеристика работы лучше защита. Данный вывод был изготовлен при сопоставлении интенсивности окрашивания пятен на радиавтографе в дорожках 7-8 и 11-12, в каких молярное соотношение олигонуклеотид : комплекс (где олигонуклеотид Г1 либо Г2) возрастает от 1:0,5 (дорвей. 7 и 11) до 1:2 (дорвей Г. С. Русских Общая характеристика работы. 8 и 12), соответственно. При подготовительной обработке дуплекса Г1•Г2 комплексом ТГК-апоА-I наблюдается образование S1-нуклеазочувствительных участков, что видно по скоплению товаров гидролиза в дорвей. 3 (рис. 4).





Рис. 5. Радиоавтограф 20% ПААГ после разделения электрофорезом товаров гидролиза Г. С. Русских Общая характеристика работы олигонуклеотида Г2 и дуплекса Г1•Г2 нуклеазой S1 в присутствии и в отсутствие комплекса кортизол-апоА-I.

  1. Г1•Г2 (5`-CC(gCC)35`-gg(Cgg)3) + [кортизол-апоА-I] при молярном соотношении дуплекс Г. С. Русских Общая характеристика работы : комплекс, равном 1:2;

  2. Г1•Г2 (5`-CC(gCC)35`-gg(Cgg)3) + [кортизол-апоА-I] + нуклеаза S1 (1:2);

  3. Г2 (5`-gg(Cgg)3);

  4. Г2 (5`-gg(Cgg)3) + нуклеаза S1;

  5. Г2 (5`-gg(Cgg)3) + [кортизол-апоА-I] + нуклеаза S1 (1:2);

  6. Г2 (5`-gg(Cgg)3) + [кортизол Г. С. Русских Общая характеристика работы-апоА-I] + нуклеаза S1 (1:0,5).


Дуплекс Г1•Г2, инкубированный с комплексом кортизол-апоА-I при молярном соотношении дуплекс : комплекс, равном 1:2 (рис. 5, дорвей. 1 и 2), обрабатывали нуклеазой S1 (дорвей. 2). Олигонуклеотид Г2 (рис. 5, дорвей Г. С. Русских Общая характеристика работы. 3) инкубировали с комплексом кортизол-апоА-I при молярных соотношениях олигонуклетид : комплекс 1:0,5 (дорвей. 6) и 1:2 (дорвей. 5), потом обрабатывали нуклеазой S1 (дорвей. 4). Дорожки 1 и 3 – контрольные.

Как надо из рис. 5, нуклеаза S1 вполне расщепляет однонитевой олигонуклеотид Г2 (дорвей Г. С. Русских Общая характеристика работы. 4), в то время как дуплекс Г1•Г2 остается негидролизованным (дорвей. 2). Для того, чтоб найти вероятные продукты гидролиза дуплекса Г1•Г2 нуклеазй S1, на 2-ую дорожку (рис. 5) наносили 2- кратную пробу. Подготовительная Г. С. Русских Общая характеристика работы обработка олигонуклеотида Г2 комплексом кортизол-апоА-I защищает его от деяния нуклеазы S1 (дорвей. 5 и 6), при этом при увеличении концентрации комплекса кортизол-апоА-I возрастает защита от деяния S1 нуклеазы, как это Г. С. Русских Общая характеристика работы наблюдалось при инкубации Г2 с комплексом ТГК-апоА-I (рис. 4, дорвей. 7-8, 11-12), т.к. возрастает количество начального негидролизованного Г2 при увеличении концентрации комплекса (рис. 5, сравн. дорвей. 5 и 6). При подготовительной обработке дуплекса Г1•Г Г. С. Русских Общая характеристика работы2 комплексом кортизол-апоА-I не наблюдается образования S1-нуклеазочувствительных участков (рис. 5, дорвей. 2) в отличие от взаимодействия этого же дуплекса с комплексом ТГК-апоА-I (рис. 4, дорвей. 3-4).





Рис. 6. Радиоавтограф 15% ПААГ после разделения электрофорезом в 6 М мочевине Г. С. Русских Общая характеристика работы товаров гидролиза олигонуклеотидов Г2Т6 и Г2 нуклеазой S1 в присутствии и в отсутствие комплекса ТГК-апоА-I.

  1. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоА-I] + нуклеаза S1, при молярном соотношении Г. С. Русских Общая характеристика работы олигонуклеотид : комплекс – 1:4, соответственно;

  2. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоА-I] + нуклеаза S1 (1:2);

  3. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоА-I] + нуклеаза S1 (1:0,5);

  4. Г2 (5`-gg(Cgg)3) + [ТГК-апоА-I] + нуклеаза S1 (1:0,5);

  5. Г Г. С. Русских Общая характеристика работы2 (5`-gg(Cgg)3) + [ТГК-апоА-I] + нуклеаза S1 (1:2);

  6. Г2 (5`-gg(Cgg)3) + [ТГК-апоА-I] + нуклеаза S1 (1:4);

  7. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоА-I] (1:2);

  8. Г2 (5`-gg(Cgg)3) + [ТГК-апоА-I] (1:2);

  9. Г2Т6 (5`-gg(Cgg Г. С. Русских Общая характеристика работы)3T6) + нуклеаза S1;

  10. Г2 (5`-gg(Cgg)3) + нуклеаза S1;

  11. Г2Т6 (5`-gg(Cgg)3T6);

  12. Г2 (5`-gg(Cgg)3).


Подобные результаты были получены нами и для других олигонуклеотидов (рис. 1), использовавшихся в работе.

Олигонуклеотид Г. С. Русских Общая характеристика работы Г2Т6 (рис. 6, дорвей. 11) за ранее инкубировали с комплексом ТГК-апоА-I при молярных соотношениях олигонуклеотид : комплекс 1:0,5 (дорвей. 3), 1:2 (дорвей. 2) и 1:4 (дорвей. 1) и обрабатывали нуклеазой S1. В контрольном опыте олигонуклеотид Г2Т6 инкубировали с Г. С. Русских Общая характеристика работы комплексом ТГК-апоА-I при молярном соотношении олигонуклеотид : комплекс, равном 1:2 (дорвей. 7), не подвергая гидролизу нуклеазой S1.

Олигонуклеотид Г2 (рис. 6, дорвей. 12) обрабатывали нуклеазой S1 (дорвей. 10), за ранее инкубируя с комплексом ТГК-апоА-I Г. С. Русских Общая характеристика работы при молярных соотношениях олигонуклеотид : комплекс 1:0,5 (дорвей. 4), 1:2 (дорвей. 5) и 1:4 (дорвей. 6). В контрольном опыте олигонуклеотид Г2 инкубировали с комплексом ТГК-апоА-I при молярном соотношении олигонуклеотид : комплекс, равном 1:2 (рис. 6, дорвей 8), не подвергая гидролизу Г. С. Русских Общая характеристика работы нуклеазой S1. Дорожки 11 и 12 содержат контрольные эталоны олигонуклеотидов.

Как надо из рис. 6, обработка олигонуклеотидов комплексом ТГК-апоА-I защищает их от деяния нуклеазы S1 (дорвей. 1-6). При увеличении концентрации комплекса усиливается защита Г2 (дорвей. 4-6), в Г. С. Русских Общая характеристика работы то время как для Г2Т6 (дорвей. 3-1) наблюдается необыкновенная закономерность. При увеличении концентрации комплекса олигонуклеотид более подвержен гидролизу нуклеазой S1. Это можно узреть при сопоставлении дорожек 3-1 и 4-6, в каких молярное соотношение олигонуклеотид Г. С. Русских Общая характеристика работы : комплекс возрастает от 1:0,5 до 1:4, соответственно.




Рис. 7. Радиоавтограф 15% ПААГ после разделения электрофорезом олигонуклеотидов Г1А6, Г2Т6 и их дуплекса Г1А6•Г2Т6, инкубированных с комплексом стероидный гормон-апоА Г. С. Русских Общая характеристика работы-I (где стероидный гормон ТГК либо кортизол) и нуклеазами S1 (Vogt V.M., 1973) и ДНКазой I (время инкубации 2 часа).

  1. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg(Cgg)3T6) + [ТГК-апоА-I] + ДНКаза I Г. С. Русских Общая характеристика работы, при молярном соотношении дуплекс : комплекс – 1:0,5, соответственно;

  2. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg(Cgg)3T6) + [ТГК-апоА-I] + ДНКаза I, (1:2);

  3. Г1А6 (5`-А6CC(gCC)3) + [ТГК-апоА-I] + нуклеаза S1, при молярном Г. С. Русских Общая характеристика работы соотношении олигонуклеотид : комплекс – (1:0,5);

  4. Г1А6 (5`-А6CC(gCC)3) + [ТГК-апоА-I] + S1, (1:2);

  5. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоА-I] + S1, (1:0,5);

  6. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоА-I] + S Г. С. Русских Общая характеристика работы1, (1:2);

  7. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg(Cgg)3T6) + [ТГК-апоА-I] (1:0,5);

  8. Г1А6 (5`-А6CC(gCC)3);

  9. Г2Т6 (5`-gg(Cgg)3T6);

  10. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg(Cgg)3T Г. С. Русских Общая характеристика работы6) + [кортизол-апоА-I] (1:0,5).


Не считая этого наблюдается образование куска Г2Т6, связывающего комплекс ТГК-апоА-I, и труднодоступного действию нуклеазы S1 (рис. 6, дорвей. 3).

Дуплекс Г1А6•Г2Т6 инкубировали с Г. С. Русских Общая характеристика работы комплексом ТГК-апоА-I при молярных соотношениях дуплекс : комплекс 1:0,5 (рис. 7, дорвей. 1) и 1:2 (дорвей. 2), потом обрабатывали ДНКазой I. Дуплекс Г1А6•Г2Т6 инкубировали с комплексами ТГК-апоА-I либо кортизол-апоА-I Г. С. Русских Общая характеристика работы при молярном соотношении дуплекс : комплекс, равном 1:0,5 (рис. 7, дорвей. 7 и 10, соответственно) не подвергая их гидролизу нуклеазами. Олигонуклеотиды Г1А6 и Г2Т6 (рис. 7, дорвей. 8 и 9, соответственно) инкубировали с комплексом ТГК-апоА-I при молярных соотношениях олигонуклеотид Г. С. Русских Общая характеристика работы : комплекс 1:0,5 (дорвей. 3 и 5) и 1:2 (дорвей. 4 и 6), потом обрабатывали нуклеазой S1.

Как надо из рис. 7, обработка дуплекса Г1А6•Г2Т6 комплексом ТГК-апоА-I (дорвей. 7) приводит к «расплетанию» дуплекса Г1А Г. С. Русских Общая характеристика работы6•Г2Т6. Это подтверждается образованием олигонуклеотидов, имеющих схожую с начальными олигонуклеотидами Г1А6 (дорвей. 8) и Г2Т6 (дорвей. 9) электрофоретическую подвижность. В то же время обработка данного дуплекса комплексом кортизол-апоА-I (дорвей. 10) не Г. С. Русских Общая характеристика работы приводит к такому результату.





Рис. 8. Радиоавтограф 15% ПААГ после разделения электрофорезом в 6 М мочевине олигонуклеотидов Г1А6 и Г2Т6 и дуплекса Г1А6•Г2Т6, инкубкированных с комплексом ТГК-апоA Г. С. Русских Общая характеристика работы-I и ДНКазой I (время инкубации 30 мин.).

  1. Г1А6 (5`-А6CC(gCC)3);

  2. Г1А6 (5`-А6CC(gCC)3) + ДНКаза I (0,75 нг/мл обскурантистской консистенции);

  3. Г1А6 (5`-А6CC(gCC)3) + ДНКаза I (0,5 нг Г. С. Русских Общая характеристика работы/мл обскурантистской консистенции);

  4. Г1А6 (5`-А6CC(gCC)3) + [ТГК-апоA-I] + ДНКаза I(0,5 нг/мл обскурантистской консистенции), при молярном соотношении олигонуклеотид : комплекс – 1:0,5;

  5. Г2Т6 (5`-gg(Cgg)3T6) + ДНКаза I (0,75 нг/мл обскурантистской консистенции);

  6. Г Г. С. Русских Общая характеристика работы2Т6 (5`-gg(Cgg)3T6) + ДНКаза I (0,5 нг/мл обскурантистской консистенции);

  7. Г2Т6 (5`-gg(Cgg)3T6) + [ТГК-апоA-I] + ДНКаза I(0,5 нг/мл обскурантистской консистенции), (1:0,5);

  8. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg Г. С. Русских Общая характеристика работы(Cgg)3T6) + ДНКаза I (0,75 нг/мл обскурантистской консистенции);

  9. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg(Cgg)3T6) + ДНКаза I (0,5 нг/мл обскурантистской консистенции);

  10. Г1А6•Г2Т6 (5`-А6CC(gCC)35`-gg Г. С. Русских Общая характеристика работы(Cgg)3T6) + [апоA-I – ТГК] + ДНКаза I (0,5 нг/мл обскурантистской консистенции), (1:0,5).


Из рис. 7 также следует, что олигонуклеотид Г1А6 гидролизуется легче, чем Г2Т6 (сравн. дорвей. 3 и 5). Возможно, это связано со Г. С. Русских Общая характеристика работы стабилизацией самокомплементарных gC-структур Tn-последовательностью, находящейся на 3`-конце.

Олигонуклеотиды Г1А6 (рис. 8, дорвей. 1) и Г2Т6 инкубировали с комплексом ТГК-апоА-I при молярном соотношении олигонуклеотид : комплекс, равном 1:0,5 (дорвей. 4 и 7, соответственно) и Г. С. Русских Общая характеристика работы обрабатывали ДНКазой I при концентрации ДНКазы I 0,5 нг/мл обскурантистской консистенции (рис. 8, дорвей. 4 и 7). Понятно, что 0,5 мкг свежайшего фермента ДНКазы I вполне разрушают 5 мг ДНК тимуса теленка за 10 мин. при комнатной температуре Г. С. Русских Общая характеристика работы (Sambrook J., et al., 1989), т.е. обскурантистские консистенции содержали фермент в количестве, достаточном для полного гидролиза олигонуклеотида (наименее 50 нг). Аналогичный опыт проводили с дуплексом Г1А6•Г2Т6 (рис. 8, дорвей. 8-10).

Как надо Г. С. Русских Общая характеристика работы из рис. 8, Г1А6 в отсутствие комплекса гидролизуется стопроцентно в избранных критериях (дорвей. 1-3) и несколько защищается комплексом ТГК-апоА-I (дорвей. 4), тогда как Г2Т6 не достаточно подвержен разрушению ДНКазой I (дорвей Г. С. Русских Общая характеристика работы. 5-7).

Понятно, что ДНКаза I гидролизует связи пурин-пиримидин (Sambrook J., et al., 1989). При поиске сведений о серьезной нуклеотидной специфики данного фермента в литературных источниках нами ничего не было найдено. Таким макаром, можно сказать Г. С. Русских Общая характеристика работы, что gC-структуры, содержащие Аn-последовательности (где n=3 либо 6) на 5`-конце, гидролизуются ДНКазой I в избранных критериях отлично (рис. 7, дорвей. 1-4), тогда как gC-структуры, содержащие Тn-последовательности (где n Г. С. Русских Общая характеристика работы=3 либо 6) на 3`-конце, меньше подвержены разрушению ДНКазой I (рис. 8, дорвей. 5-7). Возможно, это связано со стабилизацией самокомплементарных gC-структур Tn-последовательностью.

Нами было найдено, что при метилировании комплементарных олигонуклеотидных дуплексов, выявленных в составе ДНК Г. С. Русских Общая характеристика работы и применяемых в данной работе, способность комплекса ТГК-апоА-I защищать их от деяния ДНКазы I усиливается, т.е. метилирование оснований в комплементарных дуплексах не препятствует связыванию с комплексом ТГК-апоА Г. С. Русских Общая характеристика работы-I.

Из литературных данных понятно, что в эукариотических клеточках степень метилирования ДНК нередко коррелирует со степенью экспрессии гена (Гвоздев В. А., 1996). Показано, что метилируется, в главном, цитозин, находящийся после гуанозина, образуя 5-метилцитозин (Jeltsch A., 2002). Для Г. С. Русских Общая характеристика работы метилирования олигонуклеотидов использовали M.Fsp4HI – фермент, катализирующий метилирование азотистых оснований в gC-содержащих последовательностях. Для доказательства факта метилирования ДНК либо олигонуклеотидных дуплексов использовали рестиктазу Fsp4HI – фермент, расщепляющий ДНК по Г. С. Русских Общая характеристика работы неметилированным gC-содержащим последовательностям.

На рис. 9 представлены результаты гидролиза ДНКазой I и рестриктазой Fsp4HI неметилированного и метилированного дуплекса Г1А3•Г2Т3 в присутствии либо в отсутствие комплекса ТГК-апоА Г. С. Русских Общая характеристика работы-I.

Дуплекс Г1А3•Г2Т3 инкубировали с ДНКазой I (рис. 9, дорвей. 4) либо рестриктазой Fsp4HI (дорвей. 5), за ранее обработав комплексом ТГК-апоА-I при молярном соотношении дуплекс : комплекс, равном 1:4 (дорвей. 7).

Дуплекс Г. С. Русских Общая характеристика работы Г1А3•Г2Т3, метилированный при помощи MFsp4HI, подвергали действию рестриктазы Fsp4HI (рис. 9, дорвей. 6) либо ДНКазы I в течение 2 часов (дорвей. 8), за ранее инкубируя с комплексом ТГК-апоА-I при Г. С. Русских Общая характеристика работы молярном соотношении дуплекс : комплекс, равном 1:4 (дорвей. 9, 10). Дорожки с 1 по 3 - контрольные.

Как надо из рис. 9, метилирование дуплекса Г1А3•Г2Т3 размером 14 п.о. осуществляется (сравн. дорвей. 5 и 6) при помощи фермента MFsp Г. С. Русских Общая характеристика работы4HI, созданного для полимерной ДНК. Метилирование оснований в дуплексе Г1А3•Г2Т3 уменьшает действие ДНКазы I (сравн. дорвей. 4 и 8); видно, что остается больше негидролизованного дуплекса на дорвей. 8. Комплекс ТГК-апоA-I связывается с дуплексом Г. С. Русских Общая характеристика работы после метилирования его оснований, т.к. на рис. 9 видно, что он защищает метилированный дуплекс от гидролиза ДНКазой I (сравн. дорвей. 8 и 9) даже в основном, чем неметилированный (сравн. дорвей. 7 и 9).




Рис. 9. Радиоавтограф Г. С. Русских Общая характеристика работы 15% ПААГ после разделения электрофорезом в 6 М мочевине олигонуклеотидов Г1А3, Г2Т3 и дуплекса Г1А3•Г2Т3, инкубированных с MFsp4HI, комплексом ТГК-апоA-I, ДНКазой I и Fsp4HI.

  1. Г1А Г. С. Русских Общая характеристика работы3 (5`-A3CC(gCC)3);

  2. Г2Т3 (5`-gg(Cgg)3T3);

  3. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg(Cgg)3T3);

  4. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg(Cgg)3T3) + ДНКаза Г. С. Русских Общая характеристика работы I;

  5. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg(Cgg)3T3) + Fsp4HI;

  6. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg(Cgg)3T3) + MFsp4HI+ Fsp4HI;

  7. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg Г. С. Русских Общая характеристика работы(Cgg)3T3) + [ТГК-апоА-I] + ДНКаза I, при молярном соотношении дуплекс : комплекс – 1:4, соответственно;

  8. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg(Cgg)3T3) + MFsp4HI + ДНКаза I;

  9. Г1А3•Г2Т Г. С. Русских Общая характеристика работы3 (5`-A3CC(gCC)35`-gg(Cgg)3T3) + MFsp4HI + [ТГК-апоА-I] + ДНКаза I (дуплекс : комплекс – 1:4);

  10. Г1А3•Г2Т3 (5`-A3CC(gCC)35`-gg(Cgg)3T3) + MFsp4HI + [ТГК-АпоА-I Г. С. Русских Общая характеристика работы] + ДНКаза I + Fsp4HI (дуплекс : комплекс – 1:4).


Понятно, что метилирование ДНК содействует связыванию в районе промотора белков, подавляющих транскрипцию (Schäfer C. et al., 2007).

Наши данные по связыванию метилированных дуплексов Г1А3Г2Т Г. С. Русских Общая характеристика работы3 с комплексом ТГК-апоА-I указывают на способность этого комплекса оказывать влияние на регуляцию транскрипции и в районах метилированных участков генома.

^ Нуклеотидная специфика и мало достаточная нуклеотидная последовательность, взаимодействующая с комплексом ТГК-апоА Г. С. Русских Общая характеристика работы-I

Нуклеотидная последовательность, связывающая комплекс ТГК-апоА-I, становится труднодоступной действию нуклеазы S1 и ДНКазы I и представляет собой последовательность gg(Cgg)3T3±1N. Этот вывод изготовлен на основании возникновения при Г. С. Русских Общая характеристика работы обработке дуплекса Г1А6•Г2Т6 ДНКазой I олигонуклеотида, защищенного от деяния фермента, с большей электрофоретической подвижностью, чем у начальных олигонуклеотидов Г1А6 и Г2Т6 (рис. 7, дорвей. 1 и 2). Данный итог дублируется при обработке Г. С. Русских Общая характеристика работы олигонуклеотидов нуклеазой S1, что было показано на рис. 6 (дорвей. 3). Не считая этого, по электрофоретической подвижности данный олигонуклеотид приблизительно соответствует 13-15 N (Мазин А. В., Кузнеделов К. Д., 1986).

Это подтверждает ранее приобретенные Г. С. Русских Общая характеристика работы результаты об образовании одноцепочечных участков в gC-богатых районах ДНК под воздействием комплекса ТГК-апоА-I (Кузнецов П. А. и др. 2000, Панин Л. Е. и др., 2002).

Наличие открытых последовательностей ДНК в хроматине и возможность их Г. С. Русских Общая характеристика работы аффинной модификации производными олигонуклеотидов были показаны в работе (Chernolovskaya E. L. et al., 1992).

В литературе описаны S1-нуклеазочувствительные участки в промоторных районах неких генов (Santra M. et al., 1994, Wang Z. Y. et Г. С. Русских Общая характеристика работы al., 1993, McKeon C. et al., 1984). Понятно также, что промоторы многих генов общего метаболизма являются gC-богатыми (Holmquist G., 1988). Поиск по компьютерным базам данных последовательностей вида (gCC/Cgg)n показал Г. С. Русских Общая характеристика работы, что данные последовательности встречаются во всех структурах генома: экзонах, интронах, 5`- и 3`-нетранслируемых районах и достаточно нередко – в промоторных районах. Это принципиально для осознания функции исследуемого нами комплекса и роли веб-сайтов их связывания Г. С. Русских Общая характеристика работы, беря во внимание, что промоторные районы многих конститутивно экспрессирующихся генов свободны от нуклеосомной укладки.

^ Воздействие комплексов стероидный гормон-апоА-I на транскрипцию ДНК и хроматина

Паниным Л.Е. и соавторами (2002) было показано, что комплексы стероидный Г. С. Русских Общая характеристика работы гормон-апоА-I (где стероидный гормон - ТГК, АС, ДЭА, ДЭАС) вызывают повышение биосинтеза белка в культивируемых гепатоцитах. Вероятнее всего, эффективность взаимодействия неодинакова для различных гормонов и для исследования данного Г. С. Русских Общая характеристика работы нюанса нужны опыты на модельных ДНК. Также следует учесть, что в живой клеточке эффект стимуляции биосинтеза белка комплексом стероидный гормон-апоА-I развивается на фоне активации хроматина и лизосомального аппарата клеточки. Показано Г. С. Русских Общая характеристика работы, что апоА-I наращивает проницаемость лизосомальных мембран, упрощает проникновение лизосомальных протеиназ в ядро клеточки. Показано также, что гепатоцит способен захватывать протеиназы макрофагального происхождения из межклеточного места (Панин Л. Е., 1998).

На основании проведенных нами Г. С. Русских Общая характеристика работы тестов можно заключить, что комплекс ТГК-апоА-I in vitro активирует синтез РНК на ДНК-матрице выполняя роль, схожую роли фактора, изменяющего структуру ДНК, что приводит к дозозависимой активации транскрипции ДНК крысы, катализируемой гомологичными Г. С. Русских Общая характеристика работы РНК-полимеразами белкового экстракта из ядер клеток печени, но, при 200-кратном молярном излишке комплекса транскрипция стопроцентно ингибируется.

В таблице представлены результаты по синтезу 32Р-транскриптов в присутствии ТГК как в составе Г. С. Русских Общая характеристика работы комплекса с апоА-I, так и без него в критериях реакции транскрипции, катализируемой РНК-полимеразами белкового экстракта из ядер клеток печени крысы. В качестве матрицы использовалась ДНК крысы Вистар либо Г. С. Русских Общая характеристика работы ДНК в составе хроматина из ядер клеток печени крысы той же полосы.

Таблица

Синтез 32Р-транскриптов в присутствии комплекса ТГК-апоA-I, катализируемый РНК-полимеразами белкового экстракта из ядер клеток печени крысы. Матрица - ДНК крысы Г. С. Русских Общая характеристика работы.




ДНК/

комплекс

ТГК-апоА-I

Р32-транскрипты, относительное кол-во, %

Опыт 1 (контроль)

Опыт 2

Опыт 3

Опыт 4

Опыт 5

Опыт 6

1

Без комплекса

100

100

100

100

100

100

2

1:5, моль/моль

110

109

108

107

-

108

3

1:10

118

116

112

111

-

117

4

1:50

89

86

89

86

91

87

5

1:100

42

45

47

48

41

46

6

1:200

0

0

0

0

0

0

7

^ ДНК/ТГК, 1:200

16

27

21

24

23

-

Примечание: № – номер дорожки, опыт 6 – матрица – ДНК в составе хроматина.

n=5, Р0,05; где Г. С. Русских Общая характеристика работы n – количество подборки, Р – достоверность различий по сопоставлению с контролем.


Как надо из таблицы, при увеличении молярного излишка комплекса ТГК-апоА-I над ДНК до 5- и 10-кратного транскрипция активизируется, а начиная Г. С. Русских Общая характеристика работы с 50-кратного, происходит ингибирование транскрипции ДНК. ТГК вне комплекса с апоА-I также способен ингибировать транскрипцию ДНК.

На рис. 10 представлены результаты воздействия комплексов стероидный гормон–апоА-I (где стероидный гормон – ТГК Г. С. Русских Общая характеристика работы либо кортизол) на транскрипцию ДНК. В критериях реакции транскрипции ДНК (рис. 10, дорвей. 2) за ранее инкубировали с комплексами ТГК-апоА-I (дорвей. 1) либо кортизол-апоА-I (дорвей. 3) при молярном соотношении ДНК : комплекс, равном 1:10.

Связывание Г. С. Русских Общая характеристика работы ДНК с комплексами ТГК-апоА-I либо кортизол-апоА-I подтверждается конфигурацией результатов реакции транскрипции после инкубации с комплексами ТГК-апоА-I (рис. 10, дорвей. 1) либо кортизол-апоА-I (дорвей. 3) и без инкубации с комплексами Г. С. Русских Общая характеристика работы (дорвей. 2).

Как надо из рис. 10 и табл. 1, комплекс ТГК-апоА-I активирует транскрипцию ДНК, т.к. возрастает относительное содержание синтезированных 32Р-транскриптов с повышением концентрации комплекса ТГК-апоA-I до Г. С. Русских Общая характеристика работы молярного соотношения ДНК : комплекс, равного 1:10 (табл. 1, № дорвей. 1-3). Не считая того наблюдается образование транскриптов определенной длины (~70-53 N для верхнего пятна и ~12-15 N для нижнего пятна) (рис. 10, дорвей. 1), в то время как в контроле в Г. С. Русских Общая характеристика работы отсутствие комплекса ТГК-апоA-I образуются транскрипты различной длины (дорвей. 2), т.е. совсем изменяется картина транскрипции. Комплекс кортизол-апоА-I не оказывает подобного воздействия на транскрипцию ДНК (рис. 10, дорвей. 3).





Рис. 10. Транскрипция ДНК крысы Г. С. Русских Общая характеристика работы, катализируемая РНК-полимеразами белкового экстракта из ядер клеток печени крысы. Радиоавтограф 15% ПААГ после разделения электрофорезом 32Р-транскриптов суммарной РНК, образовавшейся в процессе реакции транскрипции в присутствии и в отсутствие Г. С. Русских Общая характеристика работы комплекса стероидный гормон-апоА-I (где стероидный гормон – ТГК либо кортизол).

  1. ДНК в критериях реакции транскрипции + [ТГК-апоA-I], при молярном соотношении ДНК : комплекс – 1:10;

  2. ДНК в критериях реакции транскрипции;

  3. ДНК в критериях реакции транскрипции Г. С. Русских Общая характеристика работы + [кортизол-апоA-I], при молярном соотношении ДНК : комплекс – 1:10.


При проведении данного опыта на хроматине, выделенном в нашей лаборатории с ролью Базалук В. В. по способу (Dignam J.D., 1983), были получены подобные результаты Г. С. Русских Общая характеристика работы (табл. 1, опыт 6, № дорвей. 1-3).

На рис. 11 представлена схема дозозависимого воздействия комплекса ТГК-апоА-I на транскрипцию ДНК.




Рис. 11. Схема дозозависимого воздействия комплекса ТГК-апоА-I на транскрипцию ДНК


ВЫВОДЫ

  1. Аполипопротеин A-I связывается с Г. С. Русских Общая характеристика работы дезоксирибоолигонуклеотидами (11N-21N) как в составе комплексов с кортизолом и тетрагидрокортизолом, так и в свободном состоянии.

  2. Комплементарные дуплексы CCgCCgCCgCCggCggCggCgg и AnCCgCCgCCgCCggCggCggCggTn (n = 3 и 6) становятся чувствительными к нуклеазе S1 при содействии с Г. С. Русских Общая характеристика работы комплексом тетрагидрокортизол-аполипопротеин A-I; комплекс кортизол-апоА-I такового деяния не оказывает. Олигонуклеотиды AnCC(gCC)3 в присутствии комплекса тетрагидрокортизол-апоA-I более подвержены гидролизу нуклеазой S1, чем gg(Cgg)3Tn (n Г. С. Русских Общая характеристика работы = 3 и 6). Комплекс тетрагидрокортизол-апоA-I связывается с комплементарными дуплексами после метилирования его азотистых оснований.

  3. Олигонуклеотиды gg(Cgg)3Tn (n = 3 и 6) избирательно связываются с комплексом тетрагидрокортизол-аполипопротеин A-I как в Г. С. Русских Общая характеристика работы свободном состоянии, так и в составе комплементарного дуплекса, становясь труднодоступными действию нуклеазы S1 и ДНКазы I.

  4. Мало достаточная для связывания комплекса тетрагидрокортизол-апоA-I нуклеотидная последовательность, труднодоступная действию нуклеаз, представляет собой 5`-gg(Cgg)3T3±1N Г. С. Русских Общая характеристика работы.

  5. Комплекс тетрагидрокортизол-аполипопротеин А-I дозозависимо активирует транскрипцию in vitro ДНК крысы (при молярных соотношениях ДНК : комплекс от 1:5 до 1:10), катализируемую гомологичными РНК-полимеразами; но, при 200-кратном молярном излишке комплекса транскрипция Г. С. Русских Общая характеристика работы ингибируется вполне. Комплекс тетрагидрокортизол-апоА-I способен in vitro играть роль, схожую роли фактора, изменяющего структуру ДНК в процессе транскрипции.
^ Перечень Главных ПУБЛИКАЦИЙ ПО ТЕМЕ ДИССЕРТАЦИИ

  1. Velichko E. Ju., Gimautdinova O. I Г. С. Русских Общая характеристика работы. Interaction sites of eukaryotic DNA with the steroid hormone - apolipoprotein A-I complexes // The BGRS Intern. School of Young Scientists.-Russia, Novosibirsk, 2005.

  2. Gimautdinova O. I., Velichko E. Ju., Panin L. E. The role of Г. С. Русских Общая характеристика работы DNA GCC elements binding the steroid-apoAI complex in stress conditions // Second Intern. Interdisciplinary Congress “Neuroscience for Medicine and Psychology”. -Ukraina, Sudak, 2006. – P. 78-80.

  3. Панин Л. Е., Гимаутдинова О. И Г. С. Русских Общая характеристика работы., Кузнецов П. А., Величко Е. Ю., Базалук В. В. Структура веб-сайтов взаимодействия ДНК эукариот с комплексами стероидный гормон-аполипопротеин A-I // Молек. биол. – 2007. – Т. 41, № 4. – С. 647-653.

  4. Гимаутдинова О. И., Величко Е. Ю Г. С. Русских Общая характеристика работы., Базалук В. В. Многофункциональная роль GCC/GGC последовательностей при воздействии на ДНК метаболитов стероидных гормонов в комплексе с апоАI // Бюллетень СО РАМН. – 2007. – № 6. – С. 38-40.

Перечень сокращений и обозначений

BP – бромфеноловый голубий;

Fsp4HI – эндонуклеаза Г. С. Русских Общая характеристика работы рестрикции с веб-сайтом узнавания GC^NGC либо CGN^CG;

M.Fsp4HI - ДНК-метилтрансфераза из Flavobacterium species 4HI;

N – хоть какой рибонуклеотид;

NTP – хоть какой рибонуклеозидтрифосфат;

SAM – S-аденозил-L-метионин;

XC Г. С. Русских Общая характеристика работы – ксиленцианол;

апоА-I – аполипопротеин А-I;

апоЛП – аполипопротеины;

апоЛПВП – аполипопротеины из липопротеинов высочайшей плотности;

АС, ДЭА, ДЭАС – андростерон, дегидроэпиандростерон дегидроэпиандростерон-сульфат, соответственно;

БЯЭ – белковый экстракт из ядер клеток печени крыс;

ПААГ – полиакриламидный Г. С. Русских Общая характеристика работы гель;

ТГК – тетрагидрокортизол;

ТФ – транскрипционный фактор.


Соискатель Е. Ю. Величко



g-smolensk-smolensk-istoki-russkoj-slavi-stranica-34.html
g-smolensk-smolensk-istoki-russkoj-slavi-stranica-39.html
g-smolensk-smolensk-istoki-russkoj-slavi-stranica-45.html